Protocols
- Protocols
- Competent Cells Protocol
- hTERT-RPE serum starvation for synchronization
- Immunofluorescence Protocol
- hTERT-RPE serum starvation for synchronization
- Flow Cytometry Manuals
- Fork regression/restoration/footprinting
- SMARCAL1 DNA binding ATPase assays
- PI and BrdU Flow Cytometry Protocols
- Rong’s 293T suspension+mass spec
- Lysis with DNAse for all nuclear proteins including histones
- DNA Combing Protocol
- DNA fiber labeling
- Comet Assay
- Nascent ssDNA IF assay
- 53BP1 foci
- Retro/Lentivirus production
- PEI transfection of 293T cells
- siRNA transfection optimization
- Flag-His purification mammalian cells
- ATRflox cells Cre
- ATR kinase assay
- G2/M checkpoint assay
- Freezing/Thawing cells in Liquid Nitrogen
- RPA-ssDNA pull down
- GST protein purification from bacteria
- Bacterial expression/His purification
- HeLa siRNA/plasmid transfection
- Protein solubility test in E.coli
REMEMBER: "RETROVIRUS" VECTORS AND "LENTIVIRAL" VECTORS ARE PACKAGED DIFFERENTLY. USE GP2-293 CELLS FOR VECTORS LIKE pLEGFP, pLPCX, etc.... and USE HEK293T or HEK293FT cells for Lentiviral vectors like pLPG
Note from Dave: Two Protocols. One from Carol and one from Kareem. I recommend using PEI transfection method since it yields higher tighters, uses less DNA, and is cheaper.
Lentivirus Tips
Package Retroviral Particles and Infect Target Cells
Package-Retroviral-Particles-and-Infect-Target-Cells
RETROVIRSUS (see below for Lentiviruses)
Kareem Mohni - David Cortez Laboratory
Protocol
Package Retroviruses (ie pLPCX) - 06/12/13
Reagents:
GP2-293 cells – 293T derivative expressing viral gag and pol genes
pLPCX/pLNCX – Retroviral expression plasmid
pVSV-G – VSV-G expressing plasmid
Packaging Lentiviral Particles
Day 1:
Plate 3-4 x 106 GP2-293cells in a 100mm dish. Cells should be about 60% confluent on the day of transfection.
Day 2:
Transfect cells with 4microgram pLPCX or appropriate retrovirus vector and 2ug pVSV-G using PEI based transfection method. Dilute DNA in 100uL DMEM or Optimem and add 24uL of 1ug/mL PEI. Incubate for 10-15 minutes at room temperature and add to 10mL of complete media on cells.
Day 3:
Aspirate media, wash cells once in PBS, and add 5-6mL complete media.
Day 4:
Collect media in a 15mL tube and place at 4°C. Add another 5-6mL media to the transfected cells.
Day 5:
Collect media and pool with the media from the day before in the 15mL tube. Spin the collected media at low speed to pellet any cellular debris. Move supernatant to a new 15mL tube and aliquot. Freeze aliquots at -80°C. I suggest making 1mL aliquots.
(Could filter also)
Producing Retroviral transduced cell lines: - 06/12/13
Day 1:
Add 5 x 105U2OS cells in a 60 mm dish in a volume of about 0.5-1mL. Add 2mL of retrovirus. +Add 4ug/ml final concentration of polybrene. Aim for a total volume of 2.5-3mL. Be sure and include an extra dish of cells with no virus to serve as a selection control.
Day 3:
Split the cells and move all of them to a 100mm dish and add selection media (Puromycin 1-2ug/mL, G418 1ug/mL, etc).
Day 5:
All the cells in the control dish should be dead. Split the antibiotic resistant cells as appropriate. I usually maintain them in selection levels of antibiotic for 2 passages and then bring them down to a maintenance level of half of the selection concentration.
Antibiotic Concentrations for selection:
Hela, U2OS, hTERT-RPE, and HCT-116
1-2ug/mL Puromycin (1-2 days)
1ug/mL G418 (2-4 days)
Kareem Mohni - David Cortez Laboratory
Package and Titer Lentiviruses - Updated 08/07/13
Reagents:
293T cells – for packaging
Hela/U2OS cells – for titration
pLKO.1 (shRNA expressing lentiviral plasmid) or pLPG (protein expression with weak promoter)
psPAX2 – gag/pol expressing plasmid
pMD2.g – VSV-G expressing plasmid
Packaging Lentiviral Particles
Day 1:
Plate 4-5 x 106293T cells in a 100mm dish. Cells should be about 80% confluent on the day of transfection (Day 2).
Day 2:
Transfect cells with 4ug pLKO.1, pLPG, or appropriate lentiviral vector, 3ug psPAX2, and 1ug pMD2.G in 100uL DMEM and add 24uL of 1mg/mL PEI. Incubate for 10-15 minutes at room temperature and add to 10mL of complete media on cells.
Day 3:
Aspirate media, wash cells once in PBS, and add 7mL DMEM + 10% FBS + Pen/Strep.
Day 4:
Collect media in a 15mL tube and place at 4°C. Add another 7mL media to the transfected cells.
Day 5:
Collect media and pool with the media from the day before in the 15mL tube. Spin the collected media at low speed to pellet any cellular debris. Move supernatant to a new 15mL tube and aliquot. Freeze aliquots at -80°C. I suggest making 1mL aliquots. If desired, you can filter the virus containing media through a 0.2 micron filter prior to aliquoting.
Titer Lentivirus - 10/01/10
Day 1:
Plate 1 x 106Hela cells in 35 mm dishes.
Day 2:
Infect with 100uL and 200uL lentivirus stock in a final volume of 200uL. Rock every 15 minutes for 1 hour. After 1 hour add 1mL of DMEM + 10% FBS + Pen/Strep to each plate. Do not remove the virus. Be sure to include 2 mock-infected controls.
Day 3:
Aspirate media and wash cells. Add complete media + 1-2ug/ml Puromycin to all infected dishes and one of the control plates. Do not add Puromycin to the second control plate.
Day 5:
Score cytopathic effect. All cells on the control plate treated with Puromycin should be dead and floating. Determine the least amount of virus needed to protect the entire monolayer. Consider this an MOI of 1. If the 100uL sample confers resistance to all the cells than the titer is 1 x 107Transforming Units (TU)/mL.
Tips for packaging and use of HIV-based Lentiviruses:
This protocol was optimized with pLKO.1 but works well with all HIV-based lentiviral plasmids such as pLL5 and pLenti. This is a second-generation HIV-based packaging system. It will not work for pLPCX or pLNCX.
Lentiviral shRNA:
The following shRNA sequences have been cloned into the pLKO.1 expression system available from Addgene (http://www.addgene.org/tools/protocols/plko). I have optimized protocols for packaging lentivirus, titrating virus, and infecting target cells. I will attach my extended protocol, but a basic protocol is available in the above link and in the methods section of Mohni et al 2010 (1).
All of the plasmids are Amp resistant. I recommend growing the pLKO.1 based plasmids (or pLL5, pLenti) at 200µg/mL of Amp. Alternatively, I also use 150µg/mL of Carbenicillin. The pLKO.1 plasmids have repeat sequences and replicate rather slow, so you may also need to allow a little more time for your cultures to grow. You will need high quality DNA preps of at least 1mg/mL if you plan to transfect these plasmids directly or produce lentivirus particles with them, do not use Mini-Prep DNA.
I package VSV-G pseudotyped replication defective lentivirus particles using a second generation packaging system consisting of the packaging plasmids psPAX2 (expresses gag/pol) and pMD2.G (expresses VSV G). These plasmids are both Amp resistant and grow quite well. If VSV-G pseudotyping is not appropriate for you, I have several other ecotropic (murine only) and amphotropic envelope proteins for pseudotyping. I do not have any third generation packaging plasmids (which use separate vectors to express gag and pol).
Sequences for pLKO.1 inserts (The first red sequence is the specific targeting sequence and the second red sequence is its complement).
NON-TARGETING CONTROL SEQUENCES
5’
GFP 1 FORWARD (1)
CCGGGCAAGCTGACCCTGAAGTTCACTCGAGTGAACTTCAG
GGTCAGCTTGCTTTTTG
shLuci Forward (2)
CCGGGTGCGTTGCTAGTACCAACCTCGAGGTTGGTACTAGC
AACGCACTTTTTG
shControl Forward
CCGGAAATGAACGTGAATTGCTCAACTCGAGTTGAGCAATT
CACGTTCATTTTTTTTG
ATR 1 FORWARD (1)
CCGGAACCTCCGTGATGTTGCTTGACTCGAGTCAAGCAACA
TCACGGAGGTTTTTTTG
References:
- Mohni, K. N., C. M. Livingston, D. Cortez, and S. K. Weller.2010. ATR and ATRIP are recruited to herpes simplex virus type 1 replication compartments even though ATR signaling is disabled. J Virol 84:12152-12164.
- Mohni, K. N., A. S. Mastrocola, P. Bai, S. K. Weller, and C. D. Heinen.2011. DNA mismatch repair proteins are required for efficient herpes simplex virus 1 replication. J Virol 85:12241-12253.
Carol Bansbach 03/2012 -
Day 1: 293T cells are transfected with the lentiviral packaging plasmid (pCMV-dR7.74psPAX2) and envelope plasmid (pMD2.G) using Lipofectamine 2000. ((Consider using PEI transfection method instead – less DNA for more virus and cheaper))
-Transfection protocol for 60mm dish scale:
-Prepare DNA in Optimem media. Use 5ug of dR7.7 (Box 19F2), 2ug of pMD2.G (Box 19F1), and 6ug of your lentiviral plasmid of interest in 500mL of Optimem.
-Prepare Lipofectamine 2000. Use 20uL of LF2000 + 500mL of Optimem
-Wait 5 minutes then add Lipofectamine/Optimem mix to DNA mix by pipetting
-Incubate 20 minutes
-During the incubation, prepare 293T cells.
-Mix 4.8x106 cells in 4mL of media with the LF2000/DNA mix and plate in 60mm dish
Day 3: Plate cells in the morning in 6 well dish for infection later that evening. (approx.. 6-10hrs). U2OS: 3 x 105 per well; SD31 fibroblasts: 2 x 105 per well
-Remove the media from the 293T cells and filter through a 0.45 micron syringe filter. Add polybrene (4ug/mL) to media at 2mL per 1mL of virus. Mix gently.
-Without dilution of virus at this step, MOI is likely over 1. Dilute viral media to obtain MOI of 1.
-Aspirate media from cells to be infected and add viral media. The volume should completely cover the cells. Approx. 1.5mL per well from one 60mm dish.
Day 4: Add media to cells in the morning. Passage cells in the afternoon. If all three wells were infected equally I combine 3 wells to 1-10cm dish. If not I expand 1 well to 1-60mm dish.
Day 7: 4 days after infection, assess infection efficiency by IF.