PCRcloningintoGatewaypDONRvector
Cloning into pDONR221 vector using the BP Clonase Reaction for N-terminal tagging in Gateway cloning system:
(All of this is adapted from the Gateway protocol book from Invitrogen)
1. Design primers
Forward Primer:
ggggacaagtttgtacaaaaaagcaggcttcacc + ATG…. Sequence of ORF, use 18-25 base pairs of ORF including ATG at start.
Reverse Primer:
ggggaccactttgtacaagaaagctgggtc + Antiparallel sequence of the end of ORF including stop codon, use 18-25 base pairs.
I check the PCR using Serial Cloner to tell me the Tm of the primers. Typically want to make sure the starting Tm is at least 60 degrees.
I use Pfu Ultra with 1kb/min of extension time.
I like to use a touchdown protocol – decreasing annealing temperatures. See Touchdown-dc protocol on the biorad PCR machine.
Do a 50ul PCR reaction:
Resuspend PCR primers to 100 micromolar then dilute an aliquot tp 10 micromolar.
Use 1 microliter of each primer (from 10 micromolar stock)
Use 10-100ng of template
1 microliter of 10mM dNTPs (aliquot stocks so these only go through a few cycles of freeze/thaw)
5 microliters of Pfu buffer
2 microliters of DMSO
1 microliter of Pfu Ultra
Water to 50 microliters.
Check 5 microliters of PCR on gel
If the template DNA is a vector that is kanamycin resistant, then digest PCR with 1 microliter of Dpn1 for 30 minutes at 37 degrees.
If PCR product is the correct size, then use PCR clean-up kit from Qiagen to clean-up the PCR.
Proceed to BP recombination reaction.