ATRflox cells Cre

ATRflox cells

Grow in McCoys + 10% FBS. These cells are G418 resistant. Thaw into a 10cm2 dish. You must remove the DMSO by centrifugation before the initial plating. These cells take 1-2 days to attach after thawing. Do not be concerned if the cells do not attach to the plate until 2 days after the initial thawing. After the first passage they start adhering normally.

CRE treatment:

Day 0 Plate 1 x 10⁶ cells per 10cm2 dish 24 hours before CRE treatment.

Day 1 Add 0.42ul of AdCre virus to cells in 10ml total media. I typically will dilute 2ul into 20ml of growth media then add 4.2 ml of this dilution/10cm2 dish. You can then add 5.8ml of regular growth media to bring to 10ml final. I also add pen strep to the experiment at this stage to prevent any bacterial growth.

Day 2 After 24 hours with the virus, change the media to remove the virus.

Day 3 Split the cells. I will usually harvest some at this point to do western blot and perhaps to do flow cytometry. You should have more than 25 x 10⁶ cells at this point per 10cm2 dish total. This is enough to do a lot of different types of experiments. Consider replating 1-4x10⁶ cells in each 10cm2 dish. Use other cell numbers to do other experiments.

Day 4 This is the day to do your experiments. Maximal ATR loss is seen on this day and the next day.

Day 5 complete your experiments. By day 6 many of your ATR-/- cells will be dead or will no longer be dividing.

Essential control: AdGFP infection of ATRflox cells

Good control: AdCre infection of HCT116 parental cells.

Genotype analysis Primers:

Sfiloxpseq: CAGCGGGAGCAGGCATTTC

ATR88961: GTCTACCACTGGCATAACAGC

Use 33 cycles with platinum Taq with 5.0ul of genomic DNA template.

Cycle:

95 2min

95 45sec

58 45sec

72 1min10sec

cycle 33 times

72 5min